THE GENE W-CHOC
SPECIFIES COLOR FOR THE
BEANS OF THEOBROMA CACAO.
S.J. Moorman and P. Tiwari
Department of Neuroscience and Cell Biology. Robert Wood Johnson
Medical School, Piscataway, NJ.
Historically, dark chocolate has been made from the 'nib' of the cacao bean after extracting most of the cacao butter. The cacao butter is then used to make white chocolate. We wondered whether a genetically modified cacao plant could be made to produce white beans resulting in a doubling of white chocolate production without sacrificing the purported health benefits of dark chocolate. Since a saturation mutagenesis project using the cacao tree (Theobroma cacao) is impractical because of the length of time involved in raising the plants to maturity, we adopted an insertional mutagenesis strategy to identify the gene(s) that give the cacao beans their characteristic purple color. By exposing T. cacao pollen to a proprietary solution containing the Sleeping Beauty transposon gene/enhancer trap system based in an Agrobacterium vector, we generated an estimated 225,000 independent transferred DNA (T-DNA) insertion events, which should represent near-saturation of the genome. These pollen were used to pollinate wild-type T. cacao flowers and the resulting cacao beans were screened for color. We recovered 4 white cacao beans from this screen and the T-DNA insertion sites were identified. The flanking regions were sequenced for each insertion site and the mutated genes identified. Each of the 4 white cacao beans shared an insertion in a single gene we have named w-choc. Since creating a knockout T. cacao plant would take a prohibitive length of time, we confirmed that the w-choc gene specifies bean color by using RNA interference (RNAi) technology to knock-down w-choc expression in wild-type T. cacao pollen. An SiRNA probe was designed to a target sequence of AAUGAAAGAACUUUAGAAAGA specific to the w-choc gene giving an SiRNA probe sense sequence of UGAAAGAACUUUAGAAAGATT. Wild-type T. cacao pollen were bathed in the proprietary solution containing either the sense-SiRNA probe or the antisense-SiRNA probe. These pollen were then used to pollinate wild-type T. Cacao flowers. The beans from the T. cacao plants pollinated with the w-choc knock-down pollen were white and all other beans were the natural purple. We then roasted, winnowed, melangeured, conched, tempered and molded the two batches of beans separately yielding a dark brown chocolate from the w-choc anti-sense-SiRNA beans and a white chocolate from the w-choc sense-SiRNA beans. To avoid the ethics associated with having normal people taste-test genetically modified foods, we tasted the two chocolates ourselves while blindfolded. Interestingly, in this blind taste test, both authors preferred the white chocolate despite only one author being female. This represents the first report of the molecular basis of chocolate color and has clear implications for the global production of white chocolate.
Historically, dark chocolate has been made from the 'nib' of the cacao bean after extracting most of the cacao butter. The cacao butter is then used to make white chocolate. We wondered whether a genetically modified cacao plant could be made to produce white beans resulting in a doubling of white chocolate production without sacrificing the purported health benefits of dark chocolate. Since a saturation mutagenesis project using the cacao tree (Theobroma cacao) is impractical because of the length of time involved in raising the plants to maturity, we adopted an insertional mutagenesis strategy to identify the gene(s) that give the cacao beans their characteristic purple color. By exposing T. cacao pollen to a proprietary solution containing the Sleeping Beauty transposon gene/enhancer trap system based in an Agrobacterium vector, we generated an estimated 225,000 independent transferred DNA (T-DNA) insertion events, which should represent near-saturation of the genome. These pollen were used to pollinate wild-type T. cacao flowers and the resulting cacao beans were screened for color. We recovered 4 white cacao beans from this screen and the T-DNA insertion sites were identified. The flanking regions were sequenced for each insertion site and the mutated genes identified. Each of the 4 white cacao beans shared an insertion in a single gene we have named w-choc. Since creating a knockout T. cacao plant would take a prohibitive length of time, we confirmed that the w-choc gene specifies bean color by using RNA interference (RNAi) technology to knock-down w-choc expression in wild-type T. cacao pollen. An SiRNA probe was designed to a target sequence of AAUGAAAGAACUUUAGAAAGA specific to the w-choc gene giving an SiRNA probe sense sequence of UGAAAGAACUUUAGAAAGATT. Wild-type T. cacao pollen were bathed in the proprietary solution containing either the sense-SiRNA probe or the antisense-SiRNA probe. These pollen were then used to pollinate wild-type T. Cacao flowers. The beans from the T. cacao plants pollinated with the w-choc knock-down pollen were white and all other beans were the natural purple. We then roasted, winnowed, melangeured, conched, tempered and molded the two batches of beans separately yielding a dark brown chocolate from the w-choc anti-sense-SiRNA beans and a white chocolate from the w-choc sense-SiRNA beans. To avoid the ethics associated with having normal people taste-test genetically modified foods, we tasted the two chocolates ourselves while blindfolded. Interestingly, in this blind taste test, both authors preferred the white chocolate despite only one author being female. This represents the first report of the molecular basis of chocolate color and has clear implications for the global production of white chocolate.
(last revised 8 January 2005)
Return to
Zebrafish Homepage
|
